examples/ramVar1-256#Unknown.gaps95.fa

Consensus sequence generated:

>examples/ramVar1-256#Unknown.gaps95.fa

T?AA?GTACAGTGTAGGCAAATAAGGTACTCTAAAAGGGGGCAAGGCCAAAATCGACGTGACGCAGAAAGCAAACAGCTGATCAAGCTGCAATCCAGAGACGTGAACTGCCGCTTGATCTGCTGATTACTTCGAGCCGGAGTTTCTACGTCACTTGTCGAAAACTCGATTTTGGCCCTCCCCCTTTTAGAGTACCTTATTTGCCTACACTGTA?CA???

Dotplot of consensus sequence:

Window size - 10; step size - 3; number of mismatches tolerated - 1

TIR:

Forward consensus aligned to reverse complement of consensus:

Scroll left/right to view more of alignment.

T?AA?GTACAGTGTAGGCAAATAAGGTACTCTAAAAGGGGGCAAGGCCAAAATCG----------ACGTGACGCAGA------------AAGCAAACAGCTGATCAAGCTGCAATCCAGAGACGTGAACTGCCGCTTGATCTGCTGATTACTTCGAGCCGGAGTTTCTACGTCACTTGTCGAAAACTCGATTTTGGCCCT-CCCCCTTTTAGAGTACCTTATTTGCCTACACTGTA?CA???
||||||||||||||||||||||||||||||||||| | ||||||||||| | |||||| ||| ||| || |||| |||||||| ||| | || || | ||| |||||||| |||| || | ||||| |||||| |||||||||||| | |||||||||||||||||||||||||||||||||||
NNNTGNTACAGTGTAGGCAAATAAGGTACTCTAAAAGGGGG-AGGGCCAAAATCGAGTTTTCGACAAGTGACGTAGAAACTCCGGCTCGAAGTAATCAGCAGATCAAGCGGCAGTTCACGTCTCTGGATTGCAGCTTGATCAGCTGTTTGC------------TTTCTGCGTCAC----------GTCGATTTTGGCCTTGCCCCCTTTTAGAGTACCTTATTTGCCTACACTGTACNTTNA

TSD's:

A table of potential target site duplications. K-mers shown in the table are present at either ends of the sequence.

Alignment ID: TSD's →
BDGG01000015.1_1135979-1140185None detected
BDGG01000003.1_3041908-3046113CC, AT, GACA, TCGTC
BDGG01000015.1_1218657-1222863None detected
BDGG01000001.1_6025357-6029560None detected
BDGG01000001.1_3756623-3760829CT, CG, GC, TA, TT, AC
BDGG01000003.1_2617167-2621372CTC, GCA
BDGG01000025.1_-614-3592None detected
BDGG01000008.1_1020741-1024947CG, AC, CC
BDGG01000003.1_4027918-4032124CA, GT, CG, TCT, CTT, ATC
BDGG01000002.1_799566-803772None detected
BDGG01000002.1_2777009-2781215None detected
_R_BDGG01000003.1_2209410-2213619None detected
_R_BDGG01000004.1_1172981-1177187None detected
BDGG01000018.1_48748-52954None detected
BDGG01000007.1_1170922-1175128None detected
_R_BDGG01000010.1_903502-907708CA, CG, GA, GT
BDGG01000003.1_4259902-4264108None detected
BDGG01000005.1_2991038-2995244None detected
BDGG01000017.1_186586-190792None detected
BDGG01000004.1_68959-73166None detected
ramVar1-256_UnknownNone detected

Nuleotide diversity in windows:

Window size - 10; step size - 3

3 bp1830 bp3657 bp5484 bp7311 bp1.252.493.744.99