Rust to HTML

[linkstandalone] I have been working on a bit of software called reputils. It takes an alignment of a transposable element consensus sequence to a reference genome (multiple sequence alignment), and returns an HTML file. It looks like this currently: reputils html

examples/ramVar1-256#Unknown.gaps95.fa

Consensus sequence generated:

>examples/ramVar1-256#Unknown.gaps95.fa

T?AA?GTACAGTGTAGGCAAATAAGGTACTCTAAAAGGGGGCAAGGCCAAAATCGACGTGACGCAGAAAGCAAACAGCTGATCAAGCTGCAATCCAGAGACGTGAACTGCCGCTTGATCTGCTGATTACTTCGAGCCGGAGTTTCTACGTCACTTGTCGAAAACTCGATTTTGGCCCTCCCCCTTTTAGAGTACCTTATTTGCCTACACTGTA?CA???

Dotplot of consensus sequence:

Window size - 10; step size - 3; number of mismatches tolerated - 1

TIR:

Forward consensus aligned to reverse complement of consensus:

Scroll left/right to view more of alignment.

T ? A A ? G T A C A G T G T A G G C A A A T A A G G T A C T C T A A A A G G G G G C A A G G C C A A A A T C G - - - - - - - - - - A C G T G A C G C A G A - - - - - - - - - - - - A A G C A A A C A G C T G A T C A A G C T G C A A T C C A G A G A C G T G A A C T G C C G C T T G A T C T G C T G A T T A C T T C G A G C C G G A G T T T C T A C G T C A C T T G T C G A A A A C T C G A T T T T G G C C C T - C C C C C T T T T A G A G T A C C T T A T T T G C C T A C A C T G T A ? C A ? ? ?
| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |
N N N T G N T A C A G T G T A G G C A A A T A A G G T A C T C T A A A A G G G G G - A G G G C C A A A A T C G A G T T T T C G A C A A G T G A C G T A G A A A C T C C G G C T C G A A G T A A T C A G C A G A T C A A G C G G C A G T T C A C G T C T C T G G A T T G C A G C T T G A T C A G C T G T T T G C - - - - - - - - - - - - T T T C T G C G T C A C - - - - - - - - - - G T C G A T T T T G G C C T T G C C C C C T T T T A G A G T A C C T T A T T T G C C T A C A C T G T A C N T T N A

TSD's:

A table of potential target site duplications. K-mers shown in the table are present at either ends of the sequence.

Alignment ID: TSD's →
BDGG01000015.1_1135979-1140185 None detected
BDGG01000003.1_3041908-3046113 CC, AT, GACA, TCGTC
BDGG01000015.1_1218657-1222863 None detected
BDGG01000001.1_6025357-6029560 None detected
BDGG01000001.1_3756623-3760829 CT, CG, GC, TA, TT, AC
BDGG01000003.1_2617167-2621372 CTC, GCA
BDGG01000025.1_-614-3592 None detected
BDGG01000008.1_1020741-1024947 CG, AC, CC
BDGG01000003.1_4027918-4032124 CA, GT, CG, TCT, CTT, ATC
BDGG01000002.1_799566-803772 None detected
BDGG01000002.1_2777009-2781215 None detected
_R_BDGG01000003.1_2209410-2213619 None detected
_R_BDGG01000004.1_1172981-1177187 None detected
BDGG01000018.1_48748-52954 None detected
BDGG01000007.1_1170922-1175128 None detected
_R_BDGG01000010.1_903502-907708 CA, CG, GA, GT
BDGG01000003.1_4259902-4264108 None detected
BDGG01000005.1_2991038-2995244 None detected
BDGG01000017.1_186586-190792 None detected
BDGG01000004.1_68959-73166 None detected
ramVar1-256_Unknown None detected

Nuleotide diversity in windows:

Window size - 10; step size - 3

3 bp1830 bp3657 bp5484 bp7311 bp1.252.493.744.99 Wed, 18 Aug 2021 12:59:59 +0100

Hybridisation in Saxifraga

[linkstandalone] A recreation of a cool little graph I saw in Saxifrages of Europe [1], showing the extent of hybridisation between the subsections of the genus Saxifraga. Filled circles indicate within subsection hybridisation reported, and dashed lines are uncertian hybrid reports. [1] Gornall, R. (1989). Saxifrages of Europe: With Notes on African, American and Some Asiatic Species. Christopher Helm. Wed, 14 Jul 2021 18:07:11 +0100

DToL Plant Working Group

[linkstandalone] Sun, 13 Jun 2021 18:38:25 +0100

New website

[linkstandalone] The motivation for this stripped back website, is that running Jekyll was becoming really annoying to sync between separate computers. And it's probably unneccesary for what I wanted. As I wanted to do some easy blogging (nothing major), I came across this. It's a little shell script which will create and publish blog posts from the terminal. I intend to mock them up in VSCode, as nano isn't going to cut it for me. I'm on a Mac, so the script won't work properly without GNU sed - there is somehow a difference between the two. I later have learned that Macs have ancient versions of GNU coreutils (~2005?). As for the blog executable, it's really nice! ./lb n # makes a new post ./lb p # publishes a post As for the blog, I don't really know what I'll do yet. But I may shove some of my D3 visualisations on here, talk about bits of code that I like. Or plants I like. Sun, 13 Jun 2021 17:27:50 +0100